C++ String: Exercises, Practice, Solution

C++ String [32 exercises with solution]

[An editor is available at the bottom of the page to write and execute the scripts.]

1. Write a C++ program to reverse a given string. Go to the editor
Example:
Sample Input: w3resource
Sample Output: ecruoser3w
Click me to see the sample solution

2. Write a C++ program to change every letter in a given string with the letter following it in the alphabet (ie. a becomes b, p becomes q, z becomes a). Go to the editor
Example:
Sample Input: w3resource
Sample Output: x3sftpvsdf
Click me to see the sample solution

3. Write a C++ program to capitalize the first letter of each word of a given string. Words must be separated by only one space. Go to the editor
Example:
Sample Input: cpp string exercises
Sample Output: Cpp String Exercises
Click me to see the sample solution

4. Write a C++ program to find the largest word in a given string. Go to the editor
Example:
Sample Input: C++ is a general-purpose programming language.
Sample Output: programming
Click me to see the sample solution

5. Write a C++ program to sort characters (numbers and punctuation symbols are not included) in a string. Go to the editor
Example:
Sample Input: python
Sample Output: hnopty
Click me to see the sample solution

6. Write a C++ program to check whether the characters e and g are separated by exactly 2 places anywhere in a given string at least once. Go to the editor
+ Example:
Sample Input: eagerer
Sample Output: eagerer -> 1
Click me to see the sample solution

7. Write a C++ program to count all the vowels in a given string. Go to the editor
Example:
Sample Input: eagerer
Sample output: number of vowels -> 4
Click me to see the sample solution

8. Write a C++ program to count all the words in a given string. Go to the editor
Example:
Sample Input: Python
Sample Output: number of words -> 1
Click me to see the sample solution

9. Write a C++ program to check whether two characters present equally in a given string. Go to the editor
Example:
Sample Input: aabcdeef
Sample Output: True
Click me to see the sample solution

10. Write a C++ program to check if a given string is a Palindrome or not. Go to the editor
A palindrome is a word, number, phrase, or other sequence of characters which reads the same backward as forward, such as madam, racecar.
Example:
Sample Input: madam
Sample Output: True
Click me to see the sample solution

11. Write a C++ program to find a word in a given string which has the highest number of repeated letters. Go to the editor
Example:
Sample Input: Print a welcome text in a separate line.
Sample Output: Word which has the highest number of repeated letters. separate
Click me to see the sample solution

12. Write a C++ program to insert a dash character (-) between two odd numbers in a given string of numbers. Go to the editor
Example:
Sample Input: 1345789
Sample Output: Result-> 1-345-789
Click me to see the sample solution

13. Write a C++ program to change the case (lower to upper and upper to lower cases) of each character of a given string. Go to the editor
Example:
Sample Input: Pythpn
Sample Output: pYTHON
Click me to see the sample solution

14. Write a C++ program to find the numbers in a given string and calculate the sum of all numbers. Go to the editor
Example:
Sample Input: w3resource from 2008
Sample Output: Sum of the numbers: 2011
Click me to see the sample solution

15. Write a C++ program to convert a given non-negative integer to English words. Go to the editor
Example:
Sample Input: 12
Sample Output: Twelve
Sample Input: 29
Sample Output: Twenty Nine
Click me to see the sample solution

16. Write a C++ program to find the longest common prefix from a given array of strings. Go to the editor
Example:
The longest common prefix is: Pa
The longest common prefix is: J
The longest common prefix is:
Click me to see the sample solution

17. Write a C++ program to find all combinations of well-formed brackets from a given paris of parentheses. Go to the editor
Example:
n = 2
[[]] [][]
n = 3
[[]] [][] [[[]]] [[][]] [[]][] [][[]] [][][]
Click me to see the sample solution

18. Write a C++ programming to find the length of the longest valid (correct-formed) parentheses substring of a given string. Go to the editor
Example:
Original Parentheses string: [[]
Length of longest parentheses: 2
Original Parentheses string: [[]]]
Length of longest parentheses: 4
Original Parentheses string: ]]]][[[[
Length of longest parentheses: 0
Click me to see the sample solution

19. A vowel is a syllabic speech sound pronounced without any stricture in the vocal tract. Vowels are one of the two principal classes of speech sounds, the other being the consonant. Go to the editor
Example:
Original string: w3resource
After reversing the vowels of the said string: w3resuorce
Original string: Python
After reversing the vowels of the said string: Python
Original string: Hello
After reversing the vowels of the said string: Holle
Original string: USA
After reversing the vowels of the said string: ASU
Click me to see the sample solution

20. Write a C++ program to find the length of the longest palindrome in a given string (uppercase or lowercase letters). Go to the editor
Example:
Original string: w3resource
After reversing the vowels of the said string: w3resuorce
Original string: Python
After reversing the vowels of the said string: Python
Original string: Hello
After reversing the vowels of the said string: Holle
Original string: USA
After reversing the vowels of the said string: ASU
Click me to see the sample solution

21. Write a C++ program to check whether a given string is a subsequence of another given string. Return 1 for true and 0 for false. Go to the editor
Example:
word1: apple
subse1: apl
Is subse1 is the subsequence of word1? 1
word2: apple
subse2: ppe
Is subse2 is the subsequence of word2? 1
word3: ACGGTGTCGTGCTATGCTGATGCTGACTTATATGCTA
subse3: CGTTCGGCTATGCTTCTACTTATTCTA
Is subse3 is the subsequence of word3? 1
word4: CGTTCGGCTATCGTACGTTCTATTCTATGATTTCTAA
subse4: CGTTCGGCTATGCZTTCTACTTATTCTA
Is subse4 is the subsequence of word4? 0
Click me to see the sample solution

22. Write a C++ program to remove all special characters from a given string. Go to the editor
Example:
Original string: abcd $ js# @acde$
New string after removing the special characters from the said string:
abcd js acde
Click me to see the sample solution

23. Write a C++ program that count the number of unique characters of two given strings. Go to the editor
Example:
Original Strings:
String1: Python
String2: Java
Total number of unique characters of the said two strings: 9
Click me to see the sample solution

24. Write a C++ program to count number of duplicate characters in a given string. Go to the editor
Example:
Original String:
Total number of unique characters of the said two strings.
Number of duplicate characters in the said string: 36
Click me to see the sample solution

25. Write a C++ program to find the longest sequence of consecutive ones in a given binary string. Go to the editor
Example:
Original Binary String:
1100110001
Longest sequence of consecutive ones of the said binary string:
11
Click me to see the sample solution

26. Write a C++ program to check a given string is a title cased string or not. Return "True" if the string is title cased string otherwise "False". Go to the editor
Example:
Original String:
The Quick Brown Fox.
Check the said string is a title cased string or not!
True
Click me to see the sample solution

27. Write a C++ program to insert a space when a lower character follows an upper character in a given string. Go to the editor
Example:
Original String:
TheQuickBrownFox.
Insert white spaces between lower and uppercase Letters in the said string:
The Quick Brown Fox.
Click me to see the sample solution

28. Write a C++ program to extract the first specified number of vowels from a given string. If the specified number is less than number of vowels present in the string then display "n is less than number of vowels present in the string". Go to the editor
Example:
Input a string: Input a number:
Extract the first n number of vowels from the said string:
n is less than number of vowels present in the string!
Click me to see the sample solution

29. Write a C++ program to print a given integer with commas as thousands separators. Go to the editor
Example:
Input a number:
Print the said integer with commas as thousands separators:
5,000
Click me to see the sample solution

30. Write a C++ program to identify the missing letter in a given string (list of alphabets). The method returns, "There is no missing letter!" if no letters are missing from the string. Go to the editor
Example:
Original string: abcdef
Identify the missing letter in the said string:
There is no missing letter!
Click me to see the sample solution

31. Write a C++ program to check if a given string contains only uppercase or only lowercase letters. Return "True" if the string is uppercase or lowercase, otherwise "False". Go to the editor
Example:
Original string: ABCDEF
Check whether the said string is uppercase or lowercase: True
Click me to see the sample solution

32. Write a C++ program that takes a string and reverses the words of three or more lengths in a string. Return the new string. As input characters, only spaces and letters are permitted. Go to the editor
Example:
Original string: The quick brown fox jumps over the lazy dog
Reverse the words of three or more lengths of the said string:
ehT kciuq nworb xof spmuj revo eht yzal god
Click me to see the sample solution

CPP Code Editor:

More to Come !

Do not submit any solution of the above exercises at here, if you want to contribute go to the appropriate exercise page.